Thus, the ribosome creates the proteins needed by the body strictly according to the recipe written in DNA in the form of a sequence of nucleotides. And the proteins themselves, in turn, are responsible for various characteristics and properties of a particular living organism.
It turns out to be a serious analogy with a computer program. Let’s say the goal and result of some work computer program is to construct a specific image on a computer monitor. Let it be a “drawing” of some virtual game character. For example, some virtual girl. In addition to drawing the corresponding virtual object, it would be nice if the computer program also provides the correct “ functioning” of this image on a computer monitor - will program the appropriate movements of the game character, ensure the appropriate interaction of this virtual girl with the game world around her. Etc.
In the same way, the purpose and result of the work genetic The program recorded in DNA is the construction of a specific living being. And maintaining its existence. That is, the result of the work of the genetic program is not only the construction of the body of a living creature (ciliates, earthworm or hummingbird), but also how this body will be to interact with peace: avoid dangers, look for food sources, etc.
Thus, certain analogies between a computer program and a genetic program are obvious.
Well, the difference between these programs (genetic and computer) is, firstly, the nature of the information carriers (magnetized hard drives here, and long organic molecules here). Secondly, the genetic program differs from our (even the most modern) computer program - it is extremely complex. Our computer programs are still primitive in comparison with the genetic programs by which living organisms are built. Genetic programs of living beings (individual parts of them are often called gene networks) are saturated with “switch” genes, “switches” and “switches” that control individual genes or entire gene cascades reporting to them, as well as each other. The result is something like this (Fig. 15):
Figure 15. Gene network, that is, a complex of genes that somehow interact with the FOXP2 gene, one of the key genes responsible for speech formation (Konopka et al., 2009). Only those genes that actively respond to different modifications of the FOXP2 gene (human or chimpanzine) are shown here. There are also other genes that are also related to the FOXP2 gene, but work with it regardless of which specific variant of the FOXP2 gene is in front of them.
It is clear that understanding such genetic programs is very difficult. The easiest way is to establish what interacts with what. But what it interacts for is still here, as they say, "The devil will break his leg"(WITH).
Living beings themselves are also extremely complex (at the organismal, tissue, cellular and molecular levels of organization). The organization of life at the molecular level in general represents, in fact, extremely advanced nano-technologies. Even in the simplest living cell, conveyor lines of nano-machines and nano-mechanisms, which we can only dream of in bold projects, operate successfully. For example, the famous enzyme ATP synthase is the smallest rotary motor in nature. It is clear that all these nano-machines are made from organic matter.
And the most remarkable property of living systems is their ability to continuously and independently repair themselves (continuously self-reproduce). For example, to replace the engine in your car, you must first put your car in the garage and turn it off. And then you will replace her motor (and not she herself). But the sparrow flies about its business, but right at this time in its heart, the “spent” proteins of the heart muscle are gradually replaced with new ones. That is, the heart muscle constantly rebuilds and renews itself as it works. And thus, not only the heart muscle, but also the entire body of the sparrow continuously self-reproduces itself.
However, let's return to DNA. Other DNA analogies could be: a blueprint, a recipe, or a book. But the analogy with a computer program is still closest to the essence of the matter. So (once again) there is a certain genetic program according to which this or that organism is built (and exists). This program is recorded on a special medium - long organic DNA molecules using a special language (genetic code).
This program can be divided into certain segments, sections of the DNA molecule that are responsible for one or another specific characteristic of the organism. And these segments responsible for specific traits are called genes. And the entire set of existing genes (that is, the entire genetic program of an individual organism as a whole) is called genotype. As an analogy with computer technology, individual genes can be likened to individual software functions in an overall computer program.
And now imagine. Let's say I study several genes of the already mentioned Nicole Kidman, and several similar genes of a rabbit. And I see that, in general, these genes are similar to each other. That is, the general nucleotide sequence is similar in both Nicole Kidman and the rabbit on a number of DNA segments. But I also see serious differences. Many nucleotides have been replaced by others. As a result, the output should be a slightly different protein (with a different amino acid sequence).
Let's illustrate this clearly. Let's say the first line is the nucleotide sequence of one of Nicole Kidman's genes, and the second line is the nucleotide sequence of the same rabbit gene (I have highlighted the different sections in bold):
AGTTCCCCCCGGTAATGATCATATGTGGGGGTAGACATGTTCCCCGTAAAAGTTCCGTAG
AG AAAA CC TT TAATG TTTTT ATA G Tretyakov Gallery CC GGTAGA T ATG GAA CC A TAAAGTCTGT TT
At the same time, we still do not fully understand whether there is any biological meaning in these (recorded) differences, and if so, what exactly? After all, we have so far only learned to read genetic “texts.” But we are still far from understanding these texts. That is, are these differences important so that in the first case it turns out (and functions successfully) it is Nicole Kidman, and in the second case it is precisely the rabbit? Or are these differences not important?
Although there are already approximate methods for determining such things. For example, in order to conclude whether the established differences are important or not, the proportion of so-called synonymous substitutions in relation to Not synonymous.
Synonymous substitutions are nucleotide substitutions that do not result in a change in amino acid in the protein at all. This is achieved due to degeneracy genetic code. Look at the genetic code table above (Figure 14). You will see that, for example, an amino acid proline can encode immediately four different codons: CCU, CCC, CCA, CCG. In fact, the amino acid proline is encoded by only the first two nucleotides of the “CC”. But what the third nucleotide will be there is no longer important. Whatever this third nucleotide may be, the ribosome will still produce the amino acid proline at the output if it reads “CC” in the first two “letters” of this codon.
Therefore, if we see, for example, in the Nicole Kidman gene in a certain place CCC, and in a rabbit in the same place we see CCC, then this means that the final products (proteins) of Nicole Kidman and the rabbit are - will not vary in this amino acid. This type of nucleotide replacement is called synonymous.
As a result, this could even happen. Let's say both Nicole Kidman and the rabbit have a similar protein consisting of 100 amino acids (connected to each other in a strictly defined sequence). Since each of these amino acids is encoded using a codon of 3 nucleotides, it turns out that 300 nucleotides must be used to write the “recipe” for this protein in DNA. And let’s say that about a third of these nucleotides differ between Nicole Kidman and a rabbit. That is, the differences are seemingly large (100 out of 300 nucleotides). But if they are only synonymous substitutions, it turns out that in Nicole Kidman and the rabbit the proteins under discussion will be generally identical in their amino acid sequences. That is, they will coincide on 100% .
What conclusions can be drawn from this? Firstly, from this we can assume that this protein is extremely important for both organisms. Moreover, even every amino acid is important. That is, each amino acid should be located exactly where it is in this protein. Otherwise, the protein will immediately lose its functionality.
Therefore such random mutations, which led to replacement of one or another amino acid - guaranteed to lead to the death of the mutant individual. And therefore, none of these mutations could gain a foothold in this protein.
And only mutations that did not change the amino acid composition of a given protein were able to gain a foothold. As a result, only those same synonymous substitutions that we just talked about were able to gain a foothold. Thus, when we observe exactly the described picture - the identity of the amino acid composition of the protein, in the presence of only synonymous substitutions, we can draw the following conclusions:
1). The primary structure of this protein cannot be changed at all (so as not to disrupt its function). In the “language” of the theory of evolution, in this case it is said that this gene is under very powerful pressure stabilizing selection.
2). The number of synonymous substitutions may indicate the time of existence (ancestral line) of these creatures. If there are many synonymous substitutions, it means that this line of organisms has existed on Earth for a long time. After all, point mutations are a fairly rare event. And if a significant part of synonymous replacements have already happened, it means that quite a long time has passed (since a certain moment X). If the number of even synonymous substitutions is low, then, consequently, the line of ancestors of these creatures also has a modest history (in duration).
But most often other variants of differences in genes and proteins are observed.
Let's say we see that the protein in question, consisting of 100 amino acids (respectively, written in DNA at 300 nucleotides), differs in Nicole and the rabbit in 30 places (30 nucleotides each). Moreover, 50% of synonymous substitutions take place, and another 50% Not synonymous substitutions (so-called significant replacements). That is, 15 nucleotides do not lead to the replacement of an amino acid in the protein, but the other 15 nucleotides force the ribosome to insert another amino acid into the protein.
What can we assume in this case?
First, we can assume (within the framework of evolutionary theory) that it was not too long after the ancestral line that eventually led to Nicole Kidman diverged from the ancestral line that led to rabbits. Because during this time only a small part of synonymous substitutions (out of all possible) managed to accumulate.
Secondly, we can conclude that this protein itself is quite “democratic” (tolerant) of its own amino acid composition. That is, the amino acid composition of a given protein may well change (for example, by the announced 15 amino acids), but, nevertheless, this protein will still remain capable of doing its job. And if so, then these (significant) mutations are also biologically neutral. And they could also have accumulated during this time purely by chance.
Or we can express, on the contrary, the opposite hypothesis. We can assume that these proteins are not at all different between Nicole Kidman and the rabbit. not by chance, but precisely because they must vary. That is, these proteins must work differently so that Nicole Kidman is Nicole, and the rabbit remains a rabbit.
More research is needed to determine which of the last two assumptions is more correct. For example, studying the specifics of how this particular protein works in a rabbit and in Nicole.
And finally, the third case. Let's say we still have the same protein, consisting of 100 amino acids. But we see that only 10 nucleotide differences in the corresponding gene (encoding this protein) - are synonymous in nature (do not lead to amino acid replacement), but others 40 differences in nucleotide composition are Not synonymous. That is, we see a sharp predominance of significant substitutions over synonymous ones. What conclusion can be drawn from this situation?
In this case, it becomes clear that the proteins under study in Nicole and in the rabbit actually work differently. Maybe they even perform different functions altogether. And these proteins should work differently. That is, it becomes clear that this particular protein is precisely one of those signs and properties that (including) make Nicole Kidman exactly Nicole, and a rabbit - exactly a rabbit.
Here we can attribute a relatively small number of all differences to chance, proportional number of synonymous substitutions. But the rest of the differences found between these genes can already be attributed to chance it is forbidden. After all Not In this case there are much more synonymous substitutions than synonymous ones. It follows that the gene has undergone not random changes, but directed modification under the influence of a certain strength.
And the role of this force, modifying genes in one direction or another, in modern biology by default (without any special evidence) appointed exactly natural selection.
That is, if serious differences are found between the genes of different organisms, and if these differences fall under the case we have just described (the predominance of significant substitutions over synonymous ones), then it is concluded that this is solely the result of natural selection. And nothing else.
Here is our next biologist-popularizer and writes the corresponding phrase (Naimark, 2014):
...It turned out that genes that are expressed more in the working caste passed a strong positive selection…
One feels that this author is so accustomed to the idea that only natural selection and nothing else that doesn’t even notice how it voices completely unproven things. In fact, the only established fact here is that the genes under discussion are different (in a certain way). And the reasoning about "positive natural selection"- these are just speculations made almost automatically within the framework of the accepted (today) theory of evolution.
Let's try to see what all this would look like in the computer field. Let’s say some “crazy biologist” sat down at an empty work chair next to someone else’s turned on computer and decided to examine for similarities and differences not the genetic programs of different living beings, but a mysterious set of symbols that he saw written on the monitor of this computer. The mysterious symbols that attracted the biologist’s attention were written in a text editor in the form of two similar lines:
753.11F.FF7.F1W.FF1.1HQ.1HU.811.WAC.2G8.2G6.555
We remind you that our “crazy biologist” was previously accustomed to working with such genetic texts, for example, in two different species of tits (Fig. 16):
Figure 16: Representatives of two species of tits are depicted (great tit on the left, blue tit on the right). Shown is an (imaginary) section of the DNA of these two species - a sequence of nucleotides, which, on the one hand, is very similar in these species, but at the same time is somewhat different (different nucleotides are highlighted in red).
The biologist is accustomed to looking for similarities and differences in such lines. And the discovered similarities should be attributed to either "common ancestor"(these two tits), or on "stabilizing selection". And the differences found - either on the result "positive selection", on either "neutral mutations", which have managed to accumulate in these two species of tits since the time of their divergence from their common evolutionary ancestor.
And on the computer monitor screen our biologist sees slightly different lines:
753.11F.FF7.F13.FF1.1BQ.1H1.811.WA8.2G9.2G6.555
753.11F.FF7.F1 W.FF1.1 H Q.1H U.811.WA C.2G 8 .2G6.555
The biologist notices that a significant part of these two lines are identical to each other. Naturally, our biologist will conclude that this happened due to the common origin of these two pieces of text (from a certain common ancestor). Well, our biologist will probably attribute the differences found (in bold) between these two lines to the fact that one of these areas “passed a strong positive selection” (during the struggle for existence). The biologist will calculate that the number of point substitutions in the second line compared to the first is 5 out of 36. That is, approximately 14% replacement Therefore, these lines are homologous to each other on 86% .
And everything will be very great until the owner of this computer returns to his workplace and kicks our crazy biologist out from behind the table.
At the same time, the owner of the computer will explain to the biologist that these lines, in fact, encode the facial features of two virtual girls who were created(computer owner) as two different heroines of a famous computer game Mass Effect 3.
The computer owner will explain that in this game, when creating the face of a computer character, a special set of characters is used to are encoded different features (signs) of the face. Therefore, any created face in this game can simply be written as an encoded string of characters. And if you like this face, then you can then use this code at any time when creating new characters. Specifically, those faces that correspond to the two code lines written above look like this in this game (Fig. 17):
Edited by Knunyants I.L. - M.: Foreign Literature Publishing House, 1963. - 397 p.
Download(direct link) :
uoc1.djv Previous 1 .. 66 > .. >> Next
Liz. Liz. Apr. Apr. Pro. Shaft. Liz. Shaft " "
15 16 17 18 19 20 Y" A " " "¦
" - N.Liz. Apr.
N. Apr. Pro. Shaft. Liz. HE ¦ N. Liz. Apr. Apr. HE
Thus, the tydrolysate did not contain peptides with an yl-lysyl bond, as well as peptides with an N-terminal arginyl-arginyl residue, but a peptide with a C-terminal arginyl-arginyl group was found. Presence of peptide N.Pro. ValLys.OH was not identified, although the isolation of the peptide H.Lys.Arg.Arg.OH indicates cleavage of the -Apr bond.
Pro-. Conditions for the hydrolysis of sheep corticotropin "(pH9.3, 38e, iv
6 hours) differed from the conditions under which pig corticotropin was hydrolyzed (pH 7.8-9.0, 25°, 4 hours), but this circumstance cannot explain the completely different course of hydrolysis of the hormone by trypsin. It is possible that this is due to transpeptidation reactions, as in the case of polylysine (see pp. 181-183).
Melanophorestimulating hormones. Corticotropin, in addition to corticotropic activity, also has melanophore-stimulating activity, approximately equal to the activity of pure melanophore-stimulating hormone (MSH) isolated from the pig pituitary gland. The pig pituitary gland contains two active ones. melanophore-stimulating
hormone. The main component of the hormone (a-MSH) and the second component (β-MSH) were isolated in
R. Ser. Shooting gallery Ser. Met. Glu. Gis. Fe. Apr. Three. Gli. Liz. Pro. Shaft. NH2
1 2 3 4 5 6 7 8 9 10 Il 12 13
Bonds being split
trypsin I. " "
chymotrypsin
Bonds being split
first of all
P n s. 7. The order of arrangement of amino acids in a-MSH and the bonds in it, hydrolyzed by trypsin and chymotrypsin.
pure form. The amino acid sequence of a-MSH and p-MSH [I20, 142] was determined on very small amounts of the substance.
N. Asp. Glu. Gln. Pro. Shooting gallery Liz. Met. Glu. Gns. Fe. Apr-
1 23456 7 8 9 10 11
Bonds being split
trypsin chymotrypsin
Cleavable bonds
trypsin chymotrypsin
¦ Three. Gli. Ser. Pro. Pro. Liz. Asp. HE
12 13 14 15 16 17 is
T Bonds that can be cleaved f Other bonds that can be cleaved first
Rice. 8. The order of arrangement of amino acids in β-MSH and the bonds in it, hydrolyzed by trypsin and chymotrypsin.
α-MSH (Fig. 7) has the same order of arrangement of the first thirteen amino acids of the N-terminal portion of the chain as corticotropin, but its α-amino group contains an unknown
Selective protein cleavage
deputy. In addition, a-MOG has a C-terminal amide group. α-MSH (Fig. 8) is characterized by the same sequence of amino acids in positions 7-13 as α-MSH and corticotropin in positions 4-10, but has a different sequence of amino acids at the N- and C-terminal sections of the chain.
Hydrolysis of a-MSH by trypsin yielded only two fragments corresponding to the cleavage of the -Apr.Tri- bond.
As in the case of corticotropin, the -Lys.Pro- connection turned out to be
sustainable.
Three fragments were formed from β-MSH under the influence of trypsin, while the α-Lys.Asp.OH bond turned out to be stable. The yield of all peptide fragments exceeded 80%. Since the C-terminal -Lys.Ala.OH bond in insulin was broken by trypsin, the stability of the -Lys.Asp.OH bond in β-MSH is apparently due to the combined effect of the a- and f-carboxyl groups of aspartic acid, since in both in cases before the indicated C-terminal groups there is a prolyl residue. It has been established that the lysine bond is stable in N.Tyr.Lys.Glu.OH, but not in N.Tyr.Lys.Glu.Tyr.ON. In ribonuclease (Fig. 4), the -Arg.Glu- and -Lys.Asp- bonds were easily broken.
Hypertension. The action of rennin on serum proteins produces several substances that increase blood pressure. Amino acid order
N. Asp. Apr. Shaft. Shooting gallery Shaft. Gns. Pro. Fe. Gis. Lei. HE
Bonds being split
trypsin I
chymotrypsin I I
Rice. 9. The order of arrangement of amino acids in hypertensin and the bonds in it, hydrolyzed by trypsin and chymotrypsin.
in the main component obtained from bovine blood serum is hypertensin I, which is a decapeptide. Shown in Fig. 9.
A similar amino acid sequence, but with isoleucine instead of valine, was determined for decapvptide,
Reagents that cleave bonds in a polypeptide chain
isolated from horse blood serum. This decapeptide, under the influence of an enzyme present in the blood plasma, cleaves histidinyl leucine from the C-terminal region and is converted into the octapeptide hypertensin II.
Trypsin, as would be expected based on data on its specificity of action, breaks the Arg.Val- bond in the molecule.
Other proteins. When studying the sequence of amino acids in other proteins using trypsin hydrolysis, results were obtained that are consistent with the available data on the specificity of trypsin action. However, in cases where the exact location of amino acids in the test substance is unknown, the effect of the amino acid sequence on the hydrolysis of a given protein compound by trypsin cannot be assessed.
Data on the mechanism of action of ACTH on the synthesis of steroid hormones indicate a significant role of the adenylate cyclase system. It is believed that ACTH interacts with specific receptors on the outer surface of the cell membrane (the receptors are represented by proteins in complex with other molecules, in particular sialic acid). The signal is then transmitted to the enzyme adenylate cyclase, located on the inner surface of the cell membrane, which catalyzes the breakdown of ATP and the formation of cAMP. The latter activates protein kinase, which in turn, with the participation of ATP, phosphorylates cholinesterase, which converts cholesterol esters into free cholesterol, which enters the adrenal mitochondria, which contains all the enzymes that catalyze the conversion of cholesterol into corticosteroids. Somatotropic hormone (GH, growth hormone, somatotropin) is synthesized in the acidophilic cells of the anterior pituitary gland; its concentration in the pituitary gland is 5–15 mg per 1 g of tissue. Human GH consists of 191 amino acids and contains two disulfide bonds; N- and C-terminal amino acids are represented by phenylalanine. STH has a wide range of biological effects. It affects all cells of the body, determining the intensity of metabolism of carbohydrates, proteins, lipids and minerals. It enhances the biosynthesis of protein, DNA, RNA and glycogen and at the same time promotes the mobilization of fats from storage and the breakdown of higher fatty acids and glucose in tissues. In addition to activating assimilation processes, accompanied by an increase in body size and skeletal growth, growth hormone coordinates and regulates the rate of metabolic processes. Many of the biological effects of this hormone are carried out through a special protein factor formed in the liver under the influence of the hormone - somatomedin. By its nature it turned out to be a peptide with a mol. weighing 8000. Thyroid-stimulating hormone (TSH, thyrotropin) is a complex glycoprotein and, in addition, contains two α- and β-subunits, which individually do not have biological activity: they say. its mass is about 30,000. Thyrotropin controls the development and function of the thyroid gland and regulates the biosynthesis and secretion of thyroid hormones into the blood. The primary structure of the α- and β-subunits of thyrotropin has been completely deciphered: α-subunit containing 96 amino acid residues; β-subunit of human thyrotropin, containing 112 amino acid residues, To gonadotropic hormones (gonadotropins) include follicle-stimulating hormone (FSH, follitropin) and luteinizing hormone (LH, lutropin). Both hormones are synthesized in the anterior lobe of the pituitary gland and are complex proteins - glycoproteins with a mol. weighing 25,000. They regulate steroid and gametogenesis in the gonads. Follitropin causes maturation of follicles in the ovaries in females and spermatogenesis in males. Lutropin stimulates the secretion of estrogen and progesterone in females, as well as the rupture of follicles with the formation of the corpus luteum, and in males it stimulates the secretion of testosterone and the development of interstitial tissue. The biosynthesis of gonadotropins, as noted, is regulated by the hypothalamic hormone gonadoliberin. Lutropin consists of two α- and β-subunits: the α-subunit of the hormone contains 89 amino acid residues from the N-terminus and differs in the nature of 22 amino acids.
29. Hormones of the posterior lobe of the pituitary gland: vasopressin, oxytocin. Chemical nature. The mechanism of their action, biological effect. Disorders of body functions associated with a lack of production of these hormones.
Hormones vasopressin and oxytocin synthesized by the ribosomal pathway. Both hormones are nonapeptides with the following structure: Vasopressin differs from oxytocin in two amino acids: it contains phenylalanine at position 3 from the N-terminus instead of isoleucine, and at position 8 it contains arginine instead of leucine. The main biological effect of oxytocin in mammals is associated with stimulation of contraction of the smooth muscles of the uterus during childbirth and muscle fibers around the alveoli of the mammary glands, which causes milk secretion. Vasopressin stimulates the contraction of smooth muscle fibers of blood vessels, exerting a strong vasopressor effect, but its main role in the body is the regulation of water metabolism, hence its second name, antidiuretic hormone. In small concentrations (0.2 ng per 1 kg of body weight), vasopressin has a powerful antidiuretic effect - it stimulates the reverse flow of water through the membranes of the renal tubules. Normally, it controls the osmotic pressure of blood plasma and the water balance of the human body. With pathology, in particular atrophy of the posterior lobe of the pituitary gland, diabetes insipidus develops, a disease characterized by the release of extremely large amounts of fluid in the urine. In this case, the reverse process of water absorption in the kidney tubules is disrupted.
Oxytocin
Vasopressin
30. Thyroid hormones: triiodothyronine and thyroxine. Chemical nature, biosynthesis. The mechanism of action of hormones at the molecular level, biological effect. Changes in metabolism in hyperthyroidism. The mechanism of occurrence of endemic goiter and its prevention.
Thyroxine and triiodothyronine– the main hormones of the follicular part of the thyroid gland. In addition to these hormones (the biosynthesis and functions of which will be discussed below), a peptide hormone is synthesized in special cells - the so-called parafollicular cells, or C-cells of the thyroid gland, which ensure a constant concentration of calcium in the blood. It was named ≪ calcitonin≫. The biological effect of calcitonin is directly opposite to the effect of parathyroid hormone: it causes suppression of resorptive processes in bone tissue and, accordingly, hypocalcemia and hypophosphatemia. The thyroid hormone thyroxine, which contains iodine in 4 positions of the ring structure, is easily synthesized from L-thyronine. The biological effect of thyroid hormones extends to many physiological functions of the body. In particular, hormones regulate the rate of basal metabolism, growth and differentiation of tissues, metabolism of proteins, carbohydrates and lipids, water-electrolyte metabolism, activity of the central nervous system, digestive tract, hematopoiesis, function of the cardiovascular system, the need for vitamins, the body's resistance to infections, etc. Hypothyroidism glands in early childhood leads to the development of a disease known in the literature as cretinism. In addition to growth arrest, specific changes in the skin, hair, muscles, and a sharp decrease in the speed of metabolic processes, profound mental disorders are noted with cretinism; Specific hormonal treatment in this case does not give positive results. Increased function of the thyroid gland (hyperfunction) causes the development hyperthyroidism
L-thyroxine L-3,5,3"-triiodothyronine
31. Hormones of the adrenal cortex: glucocorticoids, mineralocorticoids. Chemical nature. Mechanism of action at the molecular level. Their role in the regulation of carbohydrate, mineral, lipid and protein metabolism.
Depending on the nature of the biological effect, hormones of the adrenal cortex are conventionally divided into glucocorticoids (corticosteroids that affect the metabolism of carbohydrates, proteins, fats and nucleic acids) and mineralocorticoids (corticosteroids that have a primary effect on the metabolism of salts and water). The first include corticosterone, cortisone, hydrocortisone (cortisol), 11-deoxycortisol and 11-dehydrocorticosterone, the second - deoxycorticosterone and aldosterone. Their structure, as well as the structure of cholesterol, ergosterol, bile acids, D vitamins, sex hormones and a number of other substances, is based on the condensed ring system of. Glucocorticoids have a diverse effect on metabolism in different tissues. In muscle, lymphatic, connective and adipose tissues, glucocorticoids, exhibiting a catabolic effect, cause a decrease in the permeability of cell membranes and, accordingly, inhibition of the absorption of glucose and amino acids; at the same time, in the liver they have the opposite effect. The end result of glucocorticoid exposure is the development of hyperglycemia, mainly due to gluconeogenesis. Mineralocorticoids(deoxycorticosterone and aldosterone) mainly regulate the metabolism of sodium, potassium, chlorine and water; they contribute to the retention of sodium and chloride ions in the body and the excretion of potassium ions in the urine. Apparently, sodium and chloride ions are reabsorbed in the kidney tubules in exchange for the excretion of other metabolic products,
cortisol
32. Parathyroid hormone and calcitonin. Chemical nature. Mechanism of action at the molecular level. Effect on calcium metabolism, hypercalcemia and hypocalcemia.
Protein hormones also include parathyroid hormone (parathyroid hormone). They are synthesized by the parathyroid glands. The bovine parathyroid hormone molecule contains 84 amino acid residues and consists of one polypeptide chain. It has been found that parathyroid hormone is involved in the regulation of the concentration of calcium cations and associated phosphoric acid anions in the blood. Ionized calcium is considered the biologically active form; its concentration ranges from 1.1–1.3 mmol/l. Calcium ions turned out to be essential factors that are not replaceable by other cations for a number of vital physiological processes: muscle contraction, neuromuscular excitation, blood clotting, cell membrane permeability, activity of a number of enzymes, etc. Therefore, any changes in these processes caused by a prolonged lack of calcium in food or a violation of its absorption in the intestine lead to increased synthesis of parathyroid hormone, which promotes the leaching of calcium salts (in the form of citrates and phosphates) from bone tissue and, accordingly, to the destruction of mineral and organic components of bones. Another target organ of parathyroid hormone is the kidney. Parathyroid hormone reduces the reabsorption of phosphate in the distal tubules of the kidney and increases the tubular reabsorption of calcium. In special cells - the so-called parafollicular cells, or C-cells of the thyroid gland, a hormone of peptide nature is synthesized, ensuring a constant concentration of calcium in the blood - calcitonin. Formula:
Calcitonin contains a disulfide bridge (between the 1st and 7th amino acid residues) and is characterized by an N-terminal cysteine and a C-terminal prolinamide. The biological effect of calcitonin is directly opposite to the effect of parathyroid hormone: it causes suppression of resorptive processes in bone tissue and, accordingly, hypocalcemia and hypophosphatemia. Thus, the constancy of the level of calcium in the blood of humans and animals is ensured mainly by parathyroid hormone, calcitriol and calcitonin, i.e. hormones of both the thyroid and parathyroid glands, and a hormone derived from vitamin D3. This should be taken into account during surgical therapeutic manipulations on these glands.
33. Hormones of the adrenal medulla - catecholamines: adrenaline and norepinephrine. Chemical nature and biosynthesis. The mechanism of action of hormones at the molecular level, their role in regulating the metabolism of carbohydrates, fats and amino acids. Metabolic disorders in diseases of the adrenal glands.
These hormones are structurally reminiscent of the amino acid tyrosine, from which they differ in the presence of additional OH groups in the ring and at the β-carbon atom of the side chain and the absence of a carboxyl group.
Adrenaline Norepinephrine Isopropyladrenaline
The human adrenal medulla weighing 10 g contains about 5 mg of adrenaline and 0.5 mg of norepinephrine. Their content in the blood is 1.9 and 5.2 nmol/l, respectively. In the blood plasma, both hormones are present both in a free state and in a state bound, in particular, to albumin. Small amounts of both hormones are deposited as a salt with ATP in nerve endings, released in response to stimulation. Moreover, they are all about They have a powerful vasoconstrictor effect, causing an increase in blood pressure, and in this respect their action is similar to the action of the sympathetic nervous system. The powerful regulatory effect of these hormones on carbohydrate metabolism in the body is known. Thus, in particular, adrenaline causes a sharp increase in blood glucose levels, which is due to the acceleration of glycogen breakdown in the liver under the action of the enzyme phosphorylase. The hyperglycemic effect of norepinephrine is much lower - approximately 5% of the effect of adrenaline. In parallel, there is an accumulation of hexose phosphates in tissues, in particular in muscles, a decrease in the concentration of inorganic phosphate and an increase in the level of unsaturated fatty acids in the blood plasma. There is evidence of inhibition of glucose oxidation in tissues under the influence of adrenaline. Some authors associate this action with a decrease in the rate of penetration (transport) of glucose into the cell. It is known that both adrenaline and norepinephrine are quickly destroyed in the body; Inactive products of their metabolism are excreted in the urine, mainly in the form of 3-methoxy-4-hydroxymandelic acid, oxoadrenochrome, methoxynoadrenaline and methoxyadrenaline. These metabolites are found in urine mainly in the form associated with glucuronic acid. Enzymes that catalyze these transformations of catecholamines have been isolated from many tissues and are quite well studied, in particular monoamine oxidase (MAO), which determines the rate of biosynthesis and breakdown of catecholamines, and catechol methyltransferase, which catalyzes the main pathway of adrenaline conversion, i.e. . O- methylation due to S-adenosylmethionine. We present the structure of the two final decomposition products
34. Glucagon and insulin. Chemical nature, biosynthesis of insulin. The mechanism of action of these hormones at the molecular level. Their role in regulating the metabolism of carbohydrates, fats, and amino acids. Biochemical disorders in diabetes mellitus.
Insulin, which gets its name from the name of the pancreatic islets. The insulin molecule, containing 51 amino acid residues, consists of two polypeptide chains connected to each other at two points by disulfide bridges. In the physiological regulation of insulin synthesis, the concentration of glucose in the blood plays a dominant role. Thus, an increase in blood glucose content causes an increase in insulin secretion in the pancreatic islets, and a decrease in its content, on the contrary, slows down insulin secretion. This feedback control phenomenon is considered one of the most important mechanisms for regulating blood glucose levels. With insufficient insulin secretion, a specific disease develops - diabetes. Physiological effects of insulin: Insulin is the only hormone that reduces blood glucose levels, this is realized through:
§ increased absorption of glucose and other substances by cells;
§ activation of key glycolytic enzymes;
§ increasing the intensity of glycogen synthesis - insulin accelerates the storage of glucose in liver and muscle cells by polymerizing it into glycogen;
§ decrease in the intensity of gluconeogenesis - the formation of glucose from various substances in the liver is reduced
Anabolic effects
§ enhances the absorption of amino acids by cells (especially leucine and valine);
§ enhances the transport of potassium ions, as well as magnesium and phosphate, into the cell;
§ enhances DNA replication and protein biosynthesis;
§ enhances the synthesis of fatty acids and their subsequent esterification - in adipose tissue and in the liver, insulin promotes the conversion of glucose into triglycerides; With a lack of insulin, the opposite happens - mobilization of fats.
Anti-catabolic effects
§ suppresses protein hydrolysis - reduces protein degradation;
§ reduces lipolysis - reduces the flow of fatty acids into the blood.
Glucagon- hormone of alpha cells of the islets of Langerhans of the pancreas. According to its chemical structure, glucagon is a peptide hormone. The glucagon molecule consists of 29 amino acids and has a molecular weight of 3485. The primary structure of the glucagon molecule is as follows.
Splenin has found widespread use in healthcare practice. This spleen preparation was obtained in 1945 at the Laboratory of Experimental Endocrinology (Institute of Experimental Biology and Pathology named after A. A. Bogomolets) by Academician of the Academy of Sciences of the Ukrainian SSR V. P. Komissarenko. The chemical nature of splenin has been studied in some detail. The preparation contains a large number of amino acids, a peptide containing 13 amino acids, many fatty acids, as well as lipids, trace elements and vitamins. The active principle of splenin has not yet been isolated.
Experiments on various animal species showed a pronounced detoxifying effect of the drug.
A test of the effect of splenin in toxicosis in early pregnancy, carried out in various institutions in our country, showed that it is highly effective in the treatment of this pathology. In addition, using splenin in the treatment of complications in patients after radiotherapy, doctors noticed that after 3–4 injections of the drug the general condition of a person improves significantly: nausea and vomiting, headaches stop, appetite appears, and sleep normalizes. Due to its pronounced detoxifying properties, the drug has a pronounced therapeutic effect in the treatment of various forms of hepatitis and functional liver disorders, thyrotoxicosis, parathyroid insufficiency, schizophrenia and diabetes.
Researchers have discovered another ability of the drug - to suppress the manifestation of allergic reactions. Splenin had a pronounced therapeutic effect in the treatment of allergic rhinitis, urticaria and allergic dermatitis.
Many of the effects of splenin can be explained by its membranotropic properties, i.e., the ability to stabilize the cell membrane. Thus, red blood cells treated with this drug are less sensitive to hypotonic shock. The mechanism of many of the effects of splenin has not yet been sufficiently studied. The chemical nature of the biologically active factors included in its composition has not been clarified. Study of the drug continues.
Currently, only two peptides have been isolated from the spleen, the structure of which has been established: 1. Tuftsin, the biosynthesis of which occurs in the spleen in the form of leukokinin, and the final structure is formed on the surface of leukocyte membranes. Currently, tuftsin has been synthesized, and its biologically active analogues have also been obtained. 2. A factor resembling thymopoietin in its structure and called splenin. It, like thymopoietin, consists of 49 amino acids and has an active site of five
Tir-Liz-Pro-Arg
Taftsin
amino acids, which was named splenopentin. Splenopentin differs from thymopentin in one amino acid.
Arg-Lys-Asp-Val-Tir
Timopentin
Arg-Liz-Glu-Val-Tyr
Splenopentine
The biological effects of splenopentin and thymopentin are significantly different.
The study of humoral factors of the spleen is carried out at the Kiev Research Institute of Endocrinology and Metabolism. In recent years, a number of new important data have been obtained here, which have made it possible to significantly expand our understanding of the physiology and pathology of the functions of the spleen, and the significance of those phenomena that arise when it is disrupted. However, many mysteries of this organ remain unsolved.
Paradoxes of the animal world
When studying biologically active substances of various natures and different origins, it becomes obvious that they are conventionally divided into mediators that provide intercellular connections, hormones that transmit signals over longer distances, pheromones that are means of communication between organisms, and toxins that serve animals for protection.
Analysis of the structure of biological regulators shows that the same compound can perform different roles in different species of the animal kingdom. Luliberin acts as a hormone in the hypothalamic-pituitary system, while the same peptide in the sympathetic ganglion of the frog acts as a neurotransmitter. The mating pheromone in yeast α-factor binds to the receptors of the mammalian pituitary gland and, when acting on gonadotropes in tissue culture, causes the secretion of luteinizing hormone. The study of its chemical composition showed that it has extensive amino acid sequence homology with luliberin.
Structural homology plays an important role in the interaction of a biostimulant with a receptor, while the physiological response is determined by the functional system on which it acts.
In 1931, von Euler and Gaddum discovered a substance in extracts of the brain and intestines of animals that, when administered to an anesthetized rabbit, caused a decrease in blood pressure and increased contraction of the isolated intestine. It was called "substance P". It was later found that it is a neurotransmitter of sensitive neurons and its content in the dorsal (sensitive) roots of the spinal cord is twice as high as the concentration in the anterior roots. The structure of the substance was determined 40 years later, and it turned out that it is similar to the structure of peptides such as physalemin, isolated from the skin of a South African frog, and eledosin, found in the salivary glands of octopuses.
Arg-Pro-Lys-Pro-Gly-Gly-Fen-Gly-Leu-Met-NH 2
Substance P
Piroglu-Ala-Asp-Pro-Asp-Liz-Fep-Tri-Gly-Leu-Met-NH 2
Physalemin
Piroglu-Pro-Ser-Liz-Asp-Ala-Fen-Iley-Gly-Gly-Ley-Met-NH 2
Eledozin
These three substances have a similar structure, including homologous peptide regions, while they are obtained from different sources and perform different functions.
Another example is the peptide bombesin, which was isolated from the skin of the European frog Bombina bombina and then found in P cells of the gastric and duodenal mucosa of mammals. Bombesin functions as a releasing factor in the release of gastrin and cholecystokinin. In this regard, it causes stimulation of the stomach and pancreas, contracts the gallbladder and increases bowel movement. Using immunological research methods, it was found that the nerve cells of the cerebral cortex, hypothalamus, pituitary gland, pineal gland and cerebellum, in addition to the usual hormones of the digestive organs, also contain bombesin. It has no equal among known substances in its ability to affect thermoregulation. When it is introduced into the hypothalamic structure of the rat's brain at 4°C, a decrease in body temperature occurs - it turns out to be several degrees lower than usual in the rat. At 36° body temperature increased. This peptide was effective only when injected into the hypothalamus, where the thermoregulatory center is located. This property is probably associated with its participation in the hibernation of some animals. The injection of bombesin into the ventricles of a rat's brain caused a change in behavior and a decrease in pain sensitivity. In addition, it increases blood glucose, increases glucagon concentrations, decreases insulin levels and inhibits food intake in hungry rats. This is the only peptide that regulates the feeling of fullness, since it does not affect the frequency of food intake, but only the amount eaten. The entry of bombesin into the ventricles of the brain prevented the occurrence of stomach ulcers during stress. At the same time, the secretion of hydrochloric acid decreased and the excretion of mucus increased. Bombesin also stimulates the secretion of somatotropic and lactotropic hormones. Its properties suggest that it is a neurotransmitter in nerve structures.
In the foreign journal “Biochem. J." (1981. T. 197, No. 3) a report was published that a substance similar to the polypeptide of the mammalian pancreas was isolated from the heads of the carrion fly Calliphora vomitoria, and in another foreign journal (Insect. Biochem. 1977. T. 7. No. 5 – 6) protein fractions isolated from the beetles Adalia bipunctata, butterflies Galleria mellonella and bees are described, which in their properties are close to the somatotropic hormone of bovine blood serum.
Squirrels- high molecular weight natural polymers consisting of amino acid residues , connected by a peptide bond; are the main component of living organisms and the molecular basis of life processes.
More than 300 different amino acids are known in nature, but only 20 of them are part of the proteins of humans, animals and other higher organisms. Each amino acid has carboxyl group, amino group in the α-position (at the 2nd carbon atom) and radical (side chain), which differs among different amino acids. At physiological pH (~7.4), the carboxyl group of amino acids usually dissociates and the amino group is protonated.
All amino acids (with the exception of glycine) contain an asymmetric carbon atom (i.e., such an atom, all four valence bonds of which are occupied by different substituents, it is called a chiral center), therefore they can exist in the form of L- and D-stereoisomers (the standard is glyceraldehyde ):
For the synthesis of human proteins, only L-amino acids are used. In proteins with a long lifespan, L-isomers can slowly acquire the D-configuration, and this happens at a certain rate characteristic of each amino acid. Thus, dentin proteins of teeth contain L-aspartate, which transforms into the D-form at human body temperature at a rate of 0.01% per year. Since dental dentin is practically not exchanged or synthesized in adults in the absence of trauma, the D-aspartate content can be used to determine a person’s age, which is used in clinical and forensic practice.
All 20 amino acids in the human body differ in structure, size and physicochemical properties of the radicals attached to the α-carbon atom.
The structural formulas of 20 proteinogenic amino acids are usually given in the form of the so-called proteinogenic amino acid tables:
Recently, single-letter designations have been used to designate amino acids; a mnemonic rule (fourth column) is used to remember them.
Loading...